circad | circRNAs associated with diseases

circFAT1(e2)
Gene	FAT1	Organism	Human
Genome Locus	chr4:187627716-187630999:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30419346
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Fresh-frozen GC tissues and corresponding normal gastric epithelial tissues were collected from 38 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AACAGAAGAGAACTGGGGCG Reverse GATCAGGGTGCCAATGGTGA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Fang, J, Hong, H, Xue, X, Zhu, X, Jiang, L, Qin, M, Liang, H, Gao, L (2019). A novel circular RNA, circFAT1(e2), inhibits gastric cancer progression by targeting miR-548g in the cytoplasm and interacting with YBX1 in the nucleus. Cancer Lett., 442:222-232.